TU_205 – MG_302

Name
WID TU_205 View in model
Name MG_302 View in model
 
Structure (Hayflick media, 37C)
Structure 371494373448 MG_301 MG_302 MG_303
Genes MG_302 View in model
Promoter ‑35 box coordinate (nt) -81
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -57
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -49
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 371994, Length: 954, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
ATGCAAAAAACCAGTTTTTTAAACAAAATTGACCCACTTCTAAAATTGTG
GTTTTGACTAATTAGTTTAGTTGTTGCTTTTCTACCGCTAGGATTATATG
GTCTTGTAATTATTAACTTAGTTTTTTTAACCCTAGTTGTAATTAGTGAG
AAAAGGGTTAAAAGTGCATTAATTATTTTGAGTTGGATGTTATTTTTCTT
GTGGTTTAATGTAATTGTTAACGGTTTTATCTTTTTACCAAATACTGCTT
TAAGCGTTGATCAGAACCATAATTTTTTAGGAAGTTTTATCTATTCAGGT
GGTAATAATTTTGGTGGTGTTAGCTGGTGAAGTTTTAATCTACGTTCATT
TTTACGATCCTTTGTAATTGCATTAAGGATTAGTATGCTTTTCAGTGCTT
CTTTTTTACTGACAACTTCAAGTTCTATCTATGAATTGGCTTGAGCAGTT
GAGAGGTTTTTTAAGTTTCTTAAGTTATTTCATATTAAGGTTCAACCAAT
TAGTATCTTGCTTGCAGTTATATTTAAATTACTCCCAACTGTTAAAAGTG
AAATTATAAGAATTAAACAAGCTCAAGCTACTAGAGGTTTTATCTATAAC
AAGTGTTCGTTTTTAAATCCTTTCAAGATTAAAACCCTTTTTATTCCCGT
ATTACTTTCAACAGTTAAAAAAACAGAAACAACAGCGTTTGCTCTACAAG
CTAAAGGTTATGATTTAAATAACACTAACAGAACTCATTATCCTTTAAAA
TACAACTTATTAAACGGGGTATTTTTATTAGTGGGTTTACTTTTATTTAG
TATTTTATTAATTGCTAATAACTGGAATTTAGTTTACTGAGAAAATCCTA
ATTATAGTTTCAATTTTGATAAGCAAAACTTTATTTTTTTAAGAGCAATT
AATAGCAATAATTTGCTGTATTTTTGACAGATAGAATTAATTGCAATAGG
CTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
954
View in model
 
Metadata
Created 2012-10-01 15:09:19
Last updated 2012-10-01 15:18:38