TU_203 – MG_299

Name
WID TU_203 View in model
Name MG_299 View in model
 
Structure (Hayflick media, 37C)
Structure 368233370196 MG_298 MG_299 MG_300
Genes MG_299 View in model
Promoter ‑35 box coordinate (nt) -48
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -24
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -15
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 368733, Length: 963, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
ATGAGTGTTATTGATATTTTTAAAAAACGATTACAAGCTGTTAGTAAAAA
ACCTGTAATTATCTTTCCAGAAGGTTGATCAGCAAGTGTTTTAAAAGCAG
TTGAAATGCTTAATGAATCTAAGCTGATCCAACCTGCAGTTATCTTTCAT
AATCGTCAGGAAATCCCTGCAAATTTTGATAAAAAAATAACTCATTATGT
GATTGATGAGATGGATTTAACTAGCTATGCTAACTTTGTCTATGAAAAAC
GTAAGCATAAGGGGATGGATTTAAAAGAAGCACAAAAGTTTGTACGTGAT
CCTAGTTCTTTAGCTGCTACCTTAGTTGCTCTAAAGGTTGTTGATGGTGA
GGTTTGTGGTAAAGAATATGCTACAAAAGATACTTTAAGACCAGCTTTAC
AGTTACTAGCAACTGGTAATTTTGTTTCTAGTGTTTTCATCATGGAAAAA
GGTGAAGAACGTTTGTACTTCACTGATTGTGCTTTTGCTGTTTATCCTAA
CTCCCAAGAGTTAGCAACAATTGCTGAAAACACCTTCAATTTTGCCAAAA
GTTTAAATGAGGATGAGATAAAAATGGCTTTTTTAAGCTATTCAACGCTT
GGCAGTGGTAAGGGTGAAATGGTGGATAAAGTTGTTTTAGCAACTAAACT
ATTTTTAGAAAAACACCCTGAATTGCATCAAAGTGTTTGTGGTGAGCTCC
AGTTTGATGCTGCTTTTGTTGAAAAGGTTAGGTTACAAAAAGCACCTCAA
CTAACTTGAAAAAATAGTGCTAATATCTATGTTTTTCCTAATTTAGATGC
TGGTAACATTGCTTATAAAATCGCCCAAAGACTTGGAGGGTATGATGCAA
TTGGTCCTATTGTTCTTGGACTTTCAAGTCCAGTGAATGATCTTTCAAGG
GGAGCTAGTGTCAGTGACATTTTTAATGTTGGAATTATCACTGCCGCTCA
AGCAATTAAATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
963
View in model
 
Metadata
Created 2012-10-01 15:09:19
Last updated 2012-10-01 15:18:38