TU_200 – MG_296

Name
WID TU_200 View in model
Name MG_296 View in model
 
Structure (Hayflick media, 37C)
Structure 363526364916 MG_295 MG_296 MG_297
Genes MG_296 View in model
Promoter ‑35 box coordinate (nt) -40
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -17
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -9
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 364026, Length: 390, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
ATGAAACCACAACTTATAGCTTTTAAAAAATTTTTACAAACTGAATTTCA
AGCGGTTGATTTTGAGACTTTTCGCATTAACTTTAATTTGTGTTTAAAAC
GAGAACAAGACAATATTGTTATTTATGAAGATGATGATTATGATGACCAA
CCATTTTTTTTCAAACCAATGTTAAGTGATGGTTTTTTTATCCAAACTGA
AGTAATTAAACAGCTAGATTATCTAGCAAAAGTTGTAGAAAATCCTAAAG
ATAGTGATCAACAGTGCTGTCAAAATTTTTATGAAGCATTAATAGTGTTT
ATTTCTGCACTTGCTATTACAAAAGGCATTAATCCTAATAGATTTCACCA
AAGATTAGTAAACAGGTTTGCTATTCACGCTGTTTATTAA
50
100
150
200
250
300
350
390
View in model
 
Metadata
Created 2012-10-01 15:09:19
Last updated 2012-10-01 15:18:38