TU_197 – MG_505

Name
WID TU_197 View in model
Name MG_505 View in model
 
Structure (Hayflick media, 37C)
Structure 356975358392 MG_291 MG_292 MG_505
Genes MG_505 View in model
Promoter ‑35 box coordinate (nt) -79
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -52
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -46
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 357475, Length: 417, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
GTGAAATATATATTAGCAATTGATTTTGGCTTGAAAAAAATAGGTACAGC
AATTGCCAATACACTAGATAAATATCCTTCTGCATTTCATGTTTTTGAAG
TAAAAAATAATTTCAAAACTGCTGTTAACAACTTATTTTTGCGAATTAAA
AACGATGGGTATGAACTTGAAAAAATAGTGATAGGTTTTCCCAAATTTCA
CTATTATTCTGATATTCAAAAGGCAATTAAATCATTTAAACAACTTTTAG
AAAAACGTTTTAATTTGCCAATAATTTTGGTTGATGAAAGTAATACTACA
AGTGCTGTTAAAGATAAGCTTATAACAATGGATTTAAAACATAAGGATTT
TAAAAAGGCTAAAGATACATTAGCTGCAGTTTTAATATTAGAGCGCTTCT
TTCAAAACTATCATTAG
50
100
150
200
250
300
350
400
417
View in model
 
Metadata
Created 2012-10-01 15:09:19
Last updated 2012-10-01 15:18:38