TU_194 – MG504

Name
WID TU_194 View in model
Name MG504 View in model
 
Structure (Hayflick media, 37C)
Structure 348628349703 MG504 MG_286 MG_287
Genes MG504 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 349128, Length: 75, Direction: Forward, Sequence:
1
51
AGGGGTATAGTTCAAAGGTAGAACATCTGTCTTCAAAATAGAGTGTTGTG
GGTTCGAGTCCTGCTACCCCTGCCA
50
75
View in model
 
Metadata
Created 2012-10-01 15:09:19
Last updated 2012-10-01 15:18:38