TU_193 – MG_287

Name
WID TU_193 View in model
Name MG_287 View in model
 
Structure (Hayflick media, 37C)
Structure 348383349638 MG504 MG_286 MG_287
Genes MG_287 View in model
Promoter ‑35 box coordinate (nt) -41
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -18
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -10
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 348883, Length: 255, Direction: Forward, Sequence:
1
51
101
151
201
251
ATGCAAACGCATGAAATTCTTTTAAAAATTAAAGAAATTGCTAAATCAAA
AAACTTTAATCTTAATTTAGATGAAAAGACAATAAATCAACCACTTCGTG
AGTTGAAAATCGATTCACTTGATATGTTTAGTATTGTTGTTAGTCTAGAA
AATGAATTTGGGATTAGTTTTGATGATGAAAAGTTAATGAATCTAAAAAA
TCTTGCTGACTTGGTTTTAGAAGTTAAAAACCTTTTAGCAAAAAAAGGGG
TATAG
50
100
150
200
250
255
View in model
 
Metadata
Created 2012-10-01 15:09:19
Last updated 2012-10-01 15:18:38