TU_190 – MG_282

Name
WID TU_190 View in model
Name MG_282 View in model
 
Structure (Hayflick media, 37C)
Structure 343865345351 MG499 MG500 MG501 MG502 MG503 MG_282 MG_283
Genes MG_282 View in model
Promoter ‑35 box coordinate (nt) -56
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -26
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -18
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 344365, Length: 486, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGGAACTAAATAAAAATTACCTAACTCAAGAAGGATTTAAGCAACTGGA
AAAAGAACTTGAAAACCTAATCCAAGTTAAACGTCCTGAGATTATCAGAC
TCTTACAAGAAGCACGTGATCAGGGTGATTTAAGTGAAAATGCTGATTAT
GATGCAGCTAAAGCACAGCAAGGTGAGATTGAAACTAGGATTGCTGAAAT
TCAAGATATATTAGCCAACGCTAAGTTAATTAGTGACCACCAAGCAAAAA
CCAAAGTAACAAAAGTTAGCTTAGGGAGCACTGTTGAGATCTATGATTAC
AGTTCTAAATCGAACGAAAAATACACAATTGTAGGTACACTTGAAGCAAA
TCCTGAAGAACACAAAATTTCCAATGAATCACCCCTTGCCCTTGCAATCT
ATGGGCGTTTAATTGGTGATGAATGTGATGTTGTTGGTATTGAAGTTCCC
TATCGTGTTAAAATCCTGAAGATCAGCAACAGATAA
50
100
150
200
250
300
350
400
450
486
View in model
 
Regulation
Regulation TranscriptionalRegulation_spx_TU_190: MG_127_MONOMER View in model
 
Metadata
Created 2012-10-01 15:09:19
Last updated 2012-10-01 15:18:37