TU_188 – MG502

Name
WID TU_188 View in model
Name MG502 View in model
 
Structure (Hayflick media, 37C)
Structure 343672344747 MG499 MG500 MG501 MG502 MG503 MG_282
Genes MG502 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 344172, Length: 75, Direction: Reverse, Sequence:
1
51
TGGGATGTAGCCAAGCGGTAAGGCAATAGACTTTGACTCTATCATGCGAT
GGTTCGATCCCATCCATCCCAGCCA
50
75
View in model
 
Metadata
Created 2012-10-01 15:09:19
Last updated 2012-10-01 15:18:37