TU_187 – MG499 - MG501

Name
WID TU_187 View in model
Name MG499 - MG501 View in model
 
Structure (Hayflick media, 37C)
Structure 343384344626 MG499 MG500 MG501 MG502 MG503 MG_281 MG_282
Genes MG499, MG500, MG501 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 343884, Length: 242, Direction: Reverse, Sequence:
1
51
101
151
201
GACTCACTAGCTCAGCGGTAGAGCATTTGACTTTTAATCAAAGGGTCCCG
AGTTCGATCCTCGGGTGGGTCACCAGCCCAAGTGGCGGAATGGTAGACGC
ATGGGATTTAAGATCCCACGCCAGTAATGGTGTGCCGGTTCAAGTCCGGC
TTTGGGCACCAAATTTGTGCGAGTATAGTTTAATGGTAGAACATCAGCCT
TCCAAGCTGATCGTGTCGGTTCGATTCCGATTACTCGCTCCA
50
100
150
200
242
View in model
 
Metadata
Created 2012-10-01 15:09:18
Last updated 2012-10-01 15:18:37