TU_183 – MG_276

Name
WID TU_183 View in model
Name MG_276 View in model
 
Structure (Hayflick media, 37C)
Structure 334356335899 MG_275 MG_276 MG_277
Genes MG_276 View in model
Promoter ‑35 box coordinate (nt) -36
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -11
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -7
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 334856, Length: 543, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
ATGGATCAAAACTTTAAGTTGCTTGATCAAGCAATCAAGCGCTTTGAAAA
TTTTCCCAACCAAGGTACATTGTTTTATGACATTACCCCAGTATTTTCCA
ATCCCCAACTATTTAATTTTGTGCTAACCCAAATGGCACAGTTTATTAAA
GCTATTAATGCAGAAGCGATAGTATGTCCTGAAGCGAGGGGTTTTATCTT
TGGGGGAGCATTAGCTTCTAAAACCCAACTCCCGTTAGTATTGGTTAGAA
AAGCCAATAAACTCCCAGGGCAATTAATTAGTGCTAGCTATGATTTGGAG
TACAGAAAACATGCTGTATTGGAGATGTCAACCACTTCATTAATCCAAGC
TAATAATGCTAAAAGGTGTGTTATTGTTGATGATGTACTTGCCACTGCTG
GAACAGTTGCTGCTATTGACCAATTACTTAAACAGTTAAATGGTGAAACT
GTGGGATATTGCTTTTTAATTGAGCTGAAAAAACTCAATGGTAAAGCTAA
GTTACAACCAAATGTGGTTAGCAAGATTTTATTACATTACTAG
50
100
150
200
250
300
350
400
450
500
543
View in model
 
Metadata
Created 2012-10-01 15:09:18
Last updated 2012-10-01 15:18:37