TU_181 – MG_0002

Name
WID TU_181 View in model
Name MG_0002 View in model
 
Structure (Hayflick media, 37C)
Structure 330534331716 MG_0002 MG_272 MG_273
Genes MG_0002 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 331034, Length: 182, Direction: Reverse, Sequence:
1
51
101
151
TACCTAGCTTTATTTTTTAGAGCTAGGTACCTCATTTCATAAATTAAAGT
GATGGAAGACAACAAGAAATGCTGCCAATGCAAGTGCGAATGCGCTAAGT
GCAACAGCTGCTGTAAAAAGTAAGACAAAATTTTTGTCTAACAACTAAAA
AGCCAGTAACTAAACTGGCTTTTTTTATTTGT
50
100
150
182
View in model
 
Metadata
Created 2012-10-01 15:09:18
Last updated 2012-10-01 15:18:37