TU_178 – MG_0001

Name
WID TU_178 View in model
Name MG_0001 View in model
 
Structure (Hayflick media, 37C)
Structure 325424326507 MG_0001 MG_268 MG_269
Genes MG_0001 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 325924, Length: 83, Direction: Reverse, Sequence:
1
51
AGAACCATCACATCATTAGAGTCGAATCATGTCAGGCCAGAAATGGAGCA
GCATTAAGACTTGTCAGTGAGTGTGATGGTTTT
50
83
View in model
 
Metadata
Created 2012-10-01 15:09:18
Last updated 2012-10-01 15:18:37