TU_177 – MG_268

Name
WID TU_177 View in model
Name MG_268 View in model
 
Structure (Hayflick media, 37C)
Structure 324693326380 MG_266 MG_267 MG_268 MG_269
Genes MG_268 View in model
Promoter ‑35 box coordinate (nt) -62
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -35
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -31
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 325193, Length: 687, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
ATGCAACTAAAAAAGCCCCATTTTCAACCAAATAAAATTGCTAATTGTAT
TGTGATCGGGGGAATGATTGCTTTAGGAAAAACCACCATTGCTAATACAT
TAGCTAACCACATTCAAGCTGCAAAAGTTGTTTGTGAATTGGAAACTAAT
GACCAGTTGGTTGAACTTTTACTAGCAAAGATGTATGAACGTAGTGATGA
ATTGCTCTATTCACCTTTGTTTCAGCTTTATTTTACGCTTAATCGCTTTG
GTAAATACCAGAACAATTGCAACACTATCAATCCAACCATTTTTGATCGT
TCTATCTTTGAAGACTGGTTGTTTGCTAAGCACAACATCATTCGTCCTGC
AGTCTTTTCATACTATAACCAACTGTGAAATAGATTAGCAAAAGAACTAG
TTAATAAGCATGGGGTTCCTAATTTATATGTCATTTTGGATGGGGATTGA
AAATTATTTGAAAAAAGACTATTTATGCGTAACCGCAAAGTAGAGATTGA
TAACTTTACTAAAAATCAACTTTACTTTCAAAATTTACACAGGGTTTACA
CTGGATTTATGGAAGCGGTTTGTAATGATTTTGGGATTAATTACTGTATT
ATAGATGCAAAACTACCAATAGTAACTATTATTAAAATGATCCTTGAAAA
ATTAAAGTTACAAAAGTTAGATTGAAAATTTATCTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
687
View in model
 
Metadata
Created 2012-10-01 15:09:18
Last updated 2012-10-01 15:18:37