TU_175 – MG_264

Name
WID TU_175 View in model
Name MG_264 View in model
 
Structure (Hayflick media, 37C)
Structure 320546322143 MG_263 MG_264 MG_265
Genes MG_264 View in model
Promoter ‑35 box coordinate (nt) -38
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -11
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -8
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 321046, Length: 597, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
ATGTTAATTGCAATCGTAGGTAAACCAGGTGTTGGTAAAACCAGTCTATT
GCAATATCTCAAAGATAACTATCACTTTTCAGTTTTTTATGCAGATAGTT
TTATCCATGAACAGTACCAAAAAAACAATCCAGGTTATCAATTAATCATG
GATCATTTTGGCAAAGAGTTTGTCAATCAAACTGAAGTTGATCGTAAAAA
ACTAGCAAACTATGTTTTTAGTGATGATAAGTTAATCGAAAAACTTTCAC
TAGTAACAAAACCGCTGTTAATAGCGTGAATCAAATCCTTAAAAACCCAG
TTTCAAAAAAAGCTAGCACTAATAGAGATTGCTGTGATGCTTAACTATTG
AAATGAATATAGATCGTTGTTTGATTATGTGATTAAATTAGAAAGGGATG
ATCAGCTAGTTAACTTAGCTTTACAACAACGTAATAGTCATAAAAAAGTT
AAGGATTTGATTAAAGAGCCTAATTGCAAAATAGATACAATTTTCAACAA
CGATTCGATTGCAACAGCTGCTTTAAAGCTAATTAAGTTGCTAGAAACTT
TTTTAGAAAGAAATAAATGCCGTTGTGATTGTTGTCATATTCAGTAA
50
100
150
200
250
300
350
400
450
500
550
597
View in model
 
Metadata
Created 2012-10-01 15:09:18
Last updated 2012-10-01 15:18:37