TU_172 – MG497

Name
WID TU_172 View in model
Name MG497 View in model
 
Structure (Hayflick media, 37C)
Structure 314801315878 MG497 MG_261
Genes MG497 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 315301, Length: 77, Direction: Reverse, Sequence:
1
51
GCGCCCATAGCTCAATCGGATAGAGTGTCTGGCTTCGGACCAGAAGGTTA
TGGGTTCAAGTCCTATTGGGCGCGCCA
50
77
View in model
 
Metadata
Created 2012-10-01 15:09:18
Last updated 2012-10-01 15:18:37