TU_166 – MG493

Name
WID TU_166 View in model
Name MG493 View in model
 
Structure (Hayflick media, 37C)
Structure 304392305466 MG493 MG_254 MG_255
Genes MG493 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 304892, Length: 74, Direction: Reverse, Sequence:
1
51
GCAGATATAGTTCAATGGTAGAACATAACCTTGCCAAGGTTAAGATGCGG
GTTCGATTCCCGTTATCTGCTCCA
50
74
View in model
 
Metadata
Created 2012-10-01 15:09:18
Last updated 2012-10-01 15:18:36