TU_160 – MG_245

Name
WID TU_160 View in model
Name MG_245 View in model
 
Structure (Hayflick media, 37C)
Structure 292948294446 MG_244 MG_245 MG_246
Genes MG_245 View in model
Promoter ‑35 box coordinate (nt) -70
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -40
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -32
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 293448, Length: 498, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGGTTGATAAAAACAGTTTAAGAAAATTAATGCTTCTAAAAAGAGCAGA
ACTAAATGATCTTGAAAAATCGCATTTAGATCAAAAGATTAACCAAAAAT
TAATGGCTTTTTTAATAACAAGACCAACAATTAAAAATTTAGCACTTTAC
ATTCCCATTAAAAACGAAGTGGCTTTTTTAGATAACTTTCTAGATTTTCT
TAAGTTAAATAAAATTACAAGCTGTTTTCCTAGTATTGTTGATCAATTTA
ACATGAAGTTTATTGATCAAAATAATAATGAAATTAACCCTAATGATATT
GATTGTTTTTTTATCCCTTTATTAGCTTTTAATAAGGCAAACCACAGGAT
TGGTTTTGGTAAGGGTTATTATGACCGTTATTTATCATTAACTAGCAAAA
AACAACTAAAAATAGGGATAGCATATGACTTTCAATATGCAGAATTCACT
AATGATCCTTGGGATTATCAATTAGATTTAATTATTTGCAATGGATAA
50
100
150
200
250
300
350
400
450
498
View in model
 
Metadata
Created 2012-10-01 15:09:18
Last updated 2012-10-01 15:18:36