TU_156 – MG_240

Name
WID TU_156 View in model
Name MG_240 View in model
 
Structure (Hayflick media, 37C)
Structure 285280287333 MG_239 MG_240 MG_241
Genes MG_240 View in model
Promoter ‑35 box coordinate (nt) 115
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) 140
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) 147
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 285780, Length: 1053, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
TTGAAGCAAAAAATTATTATCTTTGGTGGTTCTTTTGACCCTATTCACAA
TGCCCATCTCTACATTGCTAAACATGCAATTAAAAAAATAAAAGCGCAAA
AGCTTTTTTTTGTACCAACTTACAATGGTATTTTTAAAAATAATTTTCAT
GCTAGTAATAAGGATAGGATTGCTATGTTAAAGCTAGCAATTAAATCAGT
CAACAATGCTTTAGTTTCCAATTTTGATATTAAAACTAAAAACGCTTTTT
CAATTAATACTGTTAACCACTTTAAAAGTTGTTATCCAACTAGTGAAATC
TATTTTTTAATAGGGAGTGATAAATTAAATGAACTTGAGAAGTGAGATCA
CATCCAACAGTTAAAAGATTTGTGCACGTTTGTTTGTTATGAACGAAAAC
CTTATCCTTTTAATAAAAAAATAGCAAACCAATTTAATGTTAAATACTTG
GCTAAATGCCCACTTGAAATCGCTTCAAGTAAACTTTTAAATCAACCTAG
AAAAAAACTGATACCACTGGCAGTTTTAAATTACATCAATACCAATCACC
TCTATCTAATTCCCACTTTAAAAGCAATGGTTGATGATAAGAGGTTTCAA
CACTGTTTAAGGGTTGGTAAACTAGCAAAACAACTAGCAATTGCAAACAA
ACTAGATGCTAAAAGAGCATTTGTTGCTGGGGCTTATCATGACTTGGCCA
AACAACTACCAGTTGATCAGTTAGTTAACATTGCAACTAGTGAACTGAAG
ATAACTAACTACCCAAGTTGAAAAGTATTACATAGCTATGTGGGGGCTTA
TATCTTAAAAAACTGATTTGGTGTTAAAGATAAAATGATTATTAATGCCA
TCAAAAACCACACCATCCCACCAAAACAAGTTAGCAAGCTAGATATGATT
GTTTATTTAGCAGATAAACTAGAACCTAACCGTAAACAGGAACAGTGGAG
TGGGGGAATTGAGATTGATCAACTAGTAAAACTAGCTAAAAGCAACTTAA
AACAGGCCTATTTAATTACCTTAAAATATGTCCAAAACCTAGTTAAAGAC
TAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1053
View in model
 
Metadata
Created 2012-10-01 15:09:18
Last updated 2012-10-01 15:18:36