TU_146 – MG492

Name
WID TU_146 View in model
Name MG492 View in model
 
Structure (Hayflick media, 37C)
Structure 265923267000 MG492 MG_219 MG_220 MG_221
Genes MG492 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 266423, Length: 77, Direction: Forward, Sequence:
1
51
GTCATCATAGCTCAATAGGACAGAGTATCAGCTTGCGGAGCTGAGGGTTA
CAGGTTCGATTCCTGTTGGTGACGCCA
50
77
View in model
 
Metadata
Created 2012-10-01 15:09:17
Last updated 2012-10-01 15:18:36