TU_145 – MG_220

Name
WID TU_145 View in model
Name MG_220 View in model
 
Structure (Hayflick media, 37C)
Structure 265575266857 MG492 MG_219 MG_220 MG_221
Genes MG_220 View in model
Promoter ‑35 box coordinate (nt) -76
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -47
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -42
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 266075, Length: 282, Direction: Reverse, Sequence:
1
51
101
151
201
251
ATGTATAAATTAGAAAAAGCACAAGCTAAGCAAGTTGTTGGTGGATTATC
TTTCTGAACTTTTAGTGCAGGACTTATTATGATAGTTAATGCACTTACTG
GGGTTGCACATGCAGTAAATGACATTTTTCAAAGTACCACAGCTAATGCC
AATGGTTCTGATGATGATAATGAGAATAAAAATAATAGTTATCGCTCTAA
AAGCAATTACTTTAACACCGCACGGTTTAAACTAGGATTAACCCCAGGTA
GTTCTTCCTATTCCTTTCCAGTTTTTAGTTAA
50
100
150
200
250
282
View in model
 
Metadata
Created 2012-10-01 15:09:17
Last updated 2012-10-01 15:18:36