TU_144 – MG_219

Name
WID TU_144 View in model
Name MG_219 View in model
 
Structure (Hayflick media, 37C)
Structure 265097266544 MG492 MG_219 MG_220 MG_491
Genes MG_219 View in model
Promoter ‑35 box coordinate (nt) -44
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -14
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -10
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 265597, Length: 447, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
ATGCGCACCAGTTACTTGAAAAAAATACCCATAATGAATAGTGATAGTGA
TCTAAAACTCCAAAAGGTGTGGATCGAGCGGCATGTTGATCAAGATGAAC
TTAGTTTAACAACTACTGCAGTTGAACTTAAAAAGAGTGATGAACAAAAA
CCTGTTGCCATTAAAAGTAGTGACTTTATTGGTCATGAAGAGTTAATCTC
TGTTCCAGTTTTACTAATCCCAACCCCTGTTGTTAAAGAGATTGATCAAC
CAGCAGTTATTCCTCCAGTTAAAGCAAAACCAAAAGCAACTAAAAAGAAA
ACTCCTGTTAAATCAAAACCAACTAGTAAATCAACTAAACAAACAAAACC
TAAACAATCCAAGCCCAAATCAAAACAAGTTCAACAAACCAAAGCTAAAC
CAACCCAAATTCAAACAAAAAAAAGCAATAAAAAAACCAGATCTTAA
50
100
150
200
250
300
350
400
447
View in model
 
Metadata
Created 2012-10-01 15:09:17
Last updated 2012-10-01 15:18:35