TU_141 – MG490

Name
WID TU_141 View in model
Name MG490 View in model
 
Structure (Hayflick media, 37C)
Structure 257318258394 MG485 MG486 MG487 MG488 MG489 MG490 MG_217
Genes MG490 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 257818, Length: 76, Direction: Forward, Sequence:
1
51
GGTCTTGTAGCTCAGTCGGTAGAGCAACGGTCTGAAGAACCGTGTGTCGG
CAGTTCGATTCTGCCCGAGACCACCA
50
76
View in model
 
Metadata
Created 2012-10-01 15:09:17
Last updated 2012-10-01 15:18:35