TU_140 – MG489

Name
WID TU_140 View in model
Name MG489 View in model
 
Structure (Hayflick media, 37C)
Structure 257242258316 MG484 MG485 MG486 MG487 MG488 MG489 MG490 MG_217
Genes MG489 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 257742, Length: 74, Direction: Forward, Sequence:
1
51
GGTTCCATGGTGTAGTGATAACATATCTCCCTGTCACGGAGGGGTTGCGG
GTTTGATTCCCGTTGGAACCGCCA
50
74
View in model
 
Metadata
Created 2012-10-01 15:09:17
Last updated 2012-10-01 15:18:35