TU_138 – MG487

Name
WID TU_138 View in model
Name MG487 View in model
 
Structure (Hayflick media, 37C)
Structure 257059258151 MG483 MG484 MG485 MG486 MG487 MG488 MG489 MG490 MG_216 MG_217
Genes MG487 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 257559, Length: 92, Direction: Forward, Sequence:
1
51
GGAGACTTACCCAAGCGGCTGAAGGGTTCGGTCTTGAAAACCGAGAGGTG
CTTTATAAGCACGCGAGGGTTCGAATCCCTCAGTCTCCGCCA
50
92
View in model
 
Metadata
Created 2012-10-01 15:09:17
Last updated 2012-10-01 15:18:35