TU_134 – MG483

Name
WID TU_134 View in model
Name MG483 View in model
 
Structure (Hayflick media, 37C)
Structure 256658257735 MG483 MG484 MG485 MG486 MG487 MG488 MG_216
Genes MG483 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 257158, Length: 77, Direction: Forward, Sequence:
1
51
GGTGCCTTAGCCAAGTGGACTCAAGGCCTGGAGCTGCAACCTCCATATCG
TCAGTTCGAATCTGACAGGCACCTCCA
50
77
View in model
 
Metadata
Created 2012-10-01 15:09:17
Last updated 2012-10-01 15:18:35