TU_130 – MG_481

Name
WID TU_130 View in model
Name MG_481 View in model
 
Structure (Hayflick media, 37C)
Structure 250308251497 MG_211 MG_480 MG_481
Genes MG_481 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 250808, Length: 189, Direction: Forward, Sequence:
1
51
101
151
GTGCCTAAGATTGAAGTTAAAAATGATGATTTAGAGCTAGCTTTAAAAAA
GTTTAAAAGGATATCACTGGAAGTACGCAGGTTAGCACAACGCCATGAAT
ACCACTTGCGCAAAGGGATGCGGTTAAGAGAAAAACAAAAGATAGCACAG
AAAAAGCGCAGGAAGTTTCGCAGTTTAGCTAGCCATTAA
50
100
150
189
View in model
 
Metadata
Created 2012-10-01 15:09:17
Last updated 2012-10-01 15:18:35