TU_129 – MG_480

Name
WID TU_129 View in model
Name MG_480 View in model
 
Structure (Hayflick media, 37C)
Structure 249649251309 MG_210 MG_211 MG_480 MG_481
Genes MG_480 View in model
Promoter ‑35 box coordinate (nt) -52
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -34
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -26
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 250149, Length: 660, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
TTGGGGAAAACAAAAAACAAATCAGACTGACAGATCTTTCTAGAAGATTA
CCGTTTTTATTTTGAAACAGATTTTGATTGGGTTACATACCTGAACAACT
GTTTAAACAGCTATCCTGATTTTGACATCATCAAGTTCATTAAGAAGTAT
GGCCCTGAGTGTGAAAAGAGCTTTCTAAGCTGACAGAGCAAAGCTAAGAG
TGATGTTTACAGTGAACTGACTAACAAGATTAAAAAACAACAGTTCTCAG
AACAGTTAATTTACCAGCTAGTCCAACTTGATGCTTTACGAACTAACTAT
TTAATTGGTTCGTTGTTTTCAGATAACAAAACCCAGCGCAAACTCCTGAA
GCGTTCTTGAAAAAATGCTAAGAAAGAAGGTTATACAAAACAAGAATGGT
TGATGATCTTAGTTGGTTTACCCTTTGAAAAAGGTGCTTATCATAAGCAG
TTATATGACCATTCACGTCAGGAGATCTTAGATCTTACTGAAGTTATTAA
AAAGCTTTATCTAAAAACAGAGACCAACAACGATAAGCTTGAGTTTGCTG
CAACTACTAGTAAAACAACAGCGCAGCTAACTAAAACTATGCCCTTAAAC
AGTAGTGATCTTGATAAGGATCTAATGGAGTTTAGTGGTGAGAAGTGAGG
TGATAATTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
660
View in model
 
Metadata
Created 2012-10-01 15:09:17
Last updated 2012-10-01 15:18:35