TU_127 – MG_207

Name
WID TU_127 View in model
Name MG_207 View in model
 
Structure (Hayflick media, 37C)
Structure 246907248411 MG_206 MG_207 MG_208
Genes MG_207 View in model
Promoter ‑35 box coordinate (nt) -31
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -6
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -3
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 247407, Length: 504, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
TTGCAAAACAAACTGATTAAGGTTTTGGTAATTGCTGATACCCATGGTCA
AAACCAGAGGTGGATTGAACTGAAAAACTACCATAACCCTGATGTGATTA
TCCATGCAGGAGATCACATGACCACTAAACAATTCATGGATCAAAATGCT
ACTTTTTGAGTGGCAGGTAACAACGATTCAATTGGCAATGAAATTGAAAT
TTTCCAGTTAGGGCAAATTAACTTTGTGTTAATGCATGGTCACCAAGCAC
CAAGAGATAACCTGAAAAAGTGGTACCAATTATTAGTTTTAAAAGCACAA
CAATACCCTTGTGATGTTTTAATCTTTGGTCATAGTCACATTGAATATAC
CAACAAAATTAATATGATCCAGTTAATCAACCCTGGTTCTCTACAACTAC
CAAGAAACCAAACCAACACCCCTTCATACTGTACCTTTATTGTCAATAAA
GACGAGCTAACTGATCTAACTATCCACTATTACCAAGCTTCAAAAGTTAG
TTAA
50
100
150
200
250
300
350
400
450
500
504
View in model
 
Metadata
Created 2012-10-01 15:09:17
Last updated 2012-10-01 15:18:35