TU_126 – MG_206

Name
WID TU_126 View in model
Name MG_206 View in model
 
Structure (Hayflick media, 37C)
Structure 245133247927 MG_205 MG_206 MG_207
Genes MG_206 View in model
Promoter ‑35 box coordinate (nt) -35
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -9
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -3
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 245633, Length: 1794, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251
1301
1351
1401
1451
1501
1551
1601
1651
1701
1751
TTGACCACTAATCTAAAACAAAAGTTAAAAACTGCACCTAAAAAACCGGG
GTGTTATTTGTGAAAAGATAGTAACGGTAAAGTTTTATATGTTGGTAAAG
CTAGTAATATTTTCAACAGGGTCCACCAGTATTTTCAAAAGAATAATCCT
TATAAAACCCAGCTATTATCAAGCCAAATTAGTGATGTTGATTTTTTCAT
TCTCAAAGATGAAAATGATGCTTTAAATCTGGAAGCAAAGCTCATTAATC
AATATCAACCCCGCTTTAACTTAGTTTTAAAACAAAACAATGGTTATCTT
TATTTTTATATCACTAAAGCCAAAAAACCTACCTTGGAATTAGCCAGAAA
ATACCAGATTAAAACCACTAAGTGCTTTGGACCGTTTGCTTCAAGTAAGT
TTAAGTTACGTGAGATCCATGACCTACTTTTAAAACTCTTTCCTTTAAGA
AAGTGTGCACCTCACCAAAAAAACCACCCGTGCTTTTATTTTCAGATGGG
TTTATGTATGGGGCAATGTATGCAAACTGATACTAAGGAAAAATACCAAC
AGGTAATTAGTAACATTGAACAGTTTTTTAATGACCCTAGTGTGGTAATT
AACTATTTAAAAGCTGCAGAAAAAAAGGCAAGTGATAATCAGGAATTTGA
AAAGGCCCAGCAGTTTCTAACACTGCAAAAAGCAGTTTTAGAGTTAACAA
AAACCCACCATACCACTATCATTAAACAAAAATCAAGCCATGATTTTATT
GGGTATGTCTTTCAAAATAACGTTTTGGCCATTACCATTTTTTGTTATGA
AAAAGGGGAGTTAACTGATAAAGAACAAGCAGTGTTTACCCTAGAGCAAA
CTGACATTGTGGAAGTTGAAAGTGCTATTATCACCTTTATCTACCACCAC
TATAAAACTACCCCACTTCCAAGTAAGATTACTGTTTCACTTGATGAAAC
TAACCTAAAACTTATTAGTGATAGCTTAAAAATTGGTGTTTTTAAGCCCA
AGAATGGTAATGAAAAACTGATCTTACAAACTGTTATTGATAATGCCAAA
CATGCACTTGCAACCAAGTGGTTGAAGTTTACTAGTAACTATGATAAAAC
CCAGCTCCACAAGGATTTAGCACAACTTCTAAATACTGATTATATCCATA
GTCTTGAGATTATTGATGTGTCATTCTATGATCAAAACCATGTTGTTGGT
TGCATGTTAAGGTTTGAAGATGGTAAAAAGATCAAACACTTATCAAGAAG
ATACAACATTAACAGTTTAAAAAAAGGTGATACTAACCACATTGCTTTAC
TTGTTTACAGAAGGATCTTAAGTGCGATGCAAACCAAAGCTAACCTCCCT
TTTAGTGATCTTTTAATTATTGATGGTGGTAAAGCACAAATTAAAAGTGT
TAAGCAAGTTTTTAGTCTCTTCAGTAATGTTAAACCACCCATTATCATTG
GACTAGTTAAAAACAAAAACCACCAAACTGATCACATTATGTTATCTGAT
TTCCAAGTTAAAAAGATAGCAATTAACTCCCCACTCTTTCACTATTTAGC
AACAATCCAAACTGAAGTTGATGGTTTTGCTAAAAGAAGTGCTTTTAATA
AGTTAAGTAACCACCAACTGCAAAACCCGTTGCTACAAATCCCAGGAGTT
GGCAAGATAACTGCCCAAATTCTCTTTGATAACTTTCAAACGCTCAATAA
CATAAAATTAGCTTCAGTTAATGAGTTAAGCCAGTTTATTAAAAAACCAT
TAGCACAAAAGATTAAAACTTACTTTGCAAAACAAACTGATTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1150
1200
1250
1300
1350
1400
1450
1500
1550
1600
1650
1700
1750
1794
View in model
 
Metadata
Created 2012-10-01 15:09:17
Last updated 2012-10-01 15:18:35