TU_123 – MG479

Name
WID TU_123 View in model
Name MG479 View in model
 
Structure (Hayflick media, 37C)
Structure 239713240787 MG479 MG_201 MG_202 MG_203
Genes MG479 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 240213, Length: 74, Direction: Reverse, Sequence:
1
51
GCCGAATTGGTTTAGGGGCAAAACAGATCCATGGTAAGGATCAGAGAACA
GTTCGACTCTGTTATTCGGCACCA
50
74
View in model
 
Metadata
Created 2012-10-01 15:09:17
Last updated 2012-10-01 15:18:35