TU_120 – MG_196 - MG_198

Name
WID TU_120 View in model
Name MG_196 - MG_198 View in model
 
Structure (Hayflick media, 37C)
Structure 235017237122 MG_195 MG_196 MG_197 MG_198 MG_199
Genes MG_196, MG_197, MG_198 View in model
Promoter ‑35 box coordinate (nt) -77
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -56
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -47
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 235517, Length: 1105, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
TTGGCACAAAACGCAAAACACCCTTCTAAAAAAGAACAAAAACCACTCGT
TAATGAACAGATTGCTTTCAATCAGTTCACTTTAATTGATGAAAACAGTA
CTAATTTAGGGATAGTTAAGATGGAAAACGCTTTAAAGTTAGCACAAGAA
AAACAGTTAGATCTAGTTCTAATTGCTCCAAACCCAACCAAACCGATCGT
TAAGTTGTTGGACTTTGGCAGATATACCTATGATTTAAAGCGTAAGAAAA
GACAAGCCAAGAAAAACCAAACAATCATCCAAACCAAAGAAGTTGTTGTC
AAACCAACGATTGCTAAACATGATTTAGAATTTAGAGCAAAACAGAGTAA
GAATTGGATAGAAAAAGGTCATCATGTCAAGTTTATAGTCCGTGCCTTTG
GCAGGGTTAGCACCAGGATAGAGTTAATTGAAAAGGTGTTTGATGACTTT
TACCAGTTAGTTAAAGATGTAGTTGAGATCCAAAAACCTTTAACCGCTTC
TTCCAAAACGATGTACGCTGCTCTATTAGTACCTTTAAAAAGATAGTTAT
GAAAACCAAAAGTGCTGCAGTAAAACGCTTTAAACTCACCAAATCAGGAC
AAATTAAGCGCAAACACGCTTATACTTCCCACCTCGCGCCCCACAAATCA
ACCAAACAAAAGCGCCATTTGCGCAAGCAAGCTACTGTGAGCAACAGTGA
ATTGAAAAGAATTGGTATTTTAATTTAGTTATGCGTGTTAAGGGAACAAA
TACAACCAGGATTAGAAGAAAAAAATGGTTAAAACAAGCTAGTGGTAGCT
TTGGGACAAGAAAAGCTTCTTTTAAGGCAGCTAAACAAACTGTTATCCAA
GCAAGCAAGTATGCTTACCGTGATAGGAGACAGAAAAAACGTGAGTTTCG
TTCGTTGTGGATCTTAAGGTTAAATGCTGCACTGCGTGCACAAGGGATGA
CTTATTCAGTGTTTATCAATGAATTGAAAAAAGCCAAGATAGTCATTAAC
AGAAAGGTACTTTCTGAACTAGCAATTAAAGAACCTAATAAGTTAAATCT
GATTATCAATACCATCAAAAAACCAACTAATAAACCAACTGTTGCAAAAA
CTTAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1050
1100
1105
View in model
 
Metadata
Created 2012-10-01 15:09:17
Last updated 2012-10-01 15:18:35