TU_117 – MG_190

Name
WID TU_117 View in model
Name MG_190 View in model
 
Structure (Hayflick media, 37C)
Structure 220107222064 MG_189 MG_190 MG_191
Genes MG_190 View in model
Promoter ‑35 box coordinate (nt) -195
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -168
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -162
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 220607, Length: 957, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
ATGAAAAAAGGATCAATAACTGAAGCAATTAATGCCATTAAACAATTTGA
TAAGATTGTTATCTTTCACCATGTGCGCCCTGATGGGGATTGTTTAGGAG
CACAACAAGGCTTGTTTCACCTCATTAAAGCTAACTTTAAAAATAAGGAG
GTGAAGTGTGTTGGTAATAACAACAACCTGTTTAGCTTTATCAACATGAC
ATTTACCAACCAAATTGATGAGAGCTTTTTAAAAGAAGCACTTGCCATTG
TGGTCGATGCTAATTACAAAAACAGGATTGAATTGAGAGAACTGTTAGAT
AAAAACCTGTTTAAAGCAGTGTTAAGGATTGATCACCATCCCAATGAAGA
TGATCTAAACACTAGCTTTAACTTTGTTGAAGAAAGCTATGTAGCTTGTT
GTGAGCAGATAGTGGAGATGGCCACAGTGGCGAAGTGGACCATACCACCA
GTGGCTGCTACTTTACTATATATAGGTATCTATACGGATAGTAATAGATT
TCTATATAGTAATACATCATATAGAACACTATACTTAGCAGCAATACTAT
ATAAAGCTAAAGCTGATATAAGGATAGTACATGATCATTTAAACCATACT
AGTTTAGCAGATCTTAAGTTTAAAAAGTATGTTTATAACCACTTTAAAAC
CCAAGGACAAGTGATCTATTTTATCTGTACTAAAAAGATCCAAAAGAGAC
TAAGAATGACTGCAGATCAATGTGCTAGAGTTAACTTGTTAAGTAACATA
GCAGATTACAAGATCTGACTTTTCTTTATTGAACAAGCTAATAATGAGAT
CAGGATAGAACTGAGGAGTAATGGGATTAATGTCAGAGATATAGCCATTA
AGTATGGTGGGGGAGGACATAATAATGCAAGTGGAGCGATCATTACTAAC
AAAAAACAAATTAGTGATGTTGTTAGTGATTGTGTGAAAAAAATTGTTTA
TAATTAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
957
View in model
 
Metadata
Created 2012-10-01 15:09:16
Last updated 2012-10-01 15:18:34