TU_112 – MG_182

Name
WID TU_112 View in model
Name MG_182 View in model
 
Structure (Hayflick media, 37C)
Structure 207343209078 MG_181 MG_182 MG_183
Genes MG_182 View in model
Promoter ‑35 box coordinate (nt) -59
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -33
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -27
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 207843, Length: 735, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
GTGGCTAGGTACTTGGGGATTGTTAGTTATGATGGCAGTTACTTTAAAGG
GTGAGCGATTCAACCAAACCTAGCTACTATCCAAGGTTTATTGGAGCAAA
GTTTTTCATTAATCATTGGCAGAAAGATAAAGGTAATTGGTTCAGGTAGA
ACTGATAAAGGGGTACATGCCATCAACCAAACCTTTCATGTTGATATTAA
TGGTGAAATTAATCTCAATTTGTTAATTAGAAAAATTAACCAGTTGATTA
AGCCCCACTGTATAGTTAAAACCTTGGTATTGGTTAACGATAGCTTTCAT
GCGCGGTTTCAAGTTAAAACCAAGGTGTATGAATATCTGATTAACTGTGG
GAATTTAAATCCGTTGCAATTTAACTATGTTTGGCAGTTAAACCAGCAAT
TGGATCTTGAAAAACTCAAAGCTGATGCCACTTTATTTTTAGGTAAGAAA
AACTTTCTTAGCTTCAGTAGTTCGATTCACACTGATTCAATTCGCACAAT
TAGTAAAATTACCATACAAAAAGAAACTAACCAACTAGTTAGACTAACTT
TTTTTGGCAGTGGTTTTCTCAGGAGTCAAGTGAGGATGATAGTTGCTTGT
TTAGTGAATTTAAACACTAATAAAATGGCACTTGAAACAGTTGCAAAATT
GTTTGAACACCCCAAGAAAGGGAGTTGTGTTGTTAAAGCCCCTAGTTGTG
GTTTGTATCTGAAAACAGTGGTATATGAAAAATAG
50
100
150
200
250
300
350
400
450
500
550
600
650
700
735
View in model
 
Metadata
Created 2012-10-01 15:09:16
Last updated 2012-10-01 15:18:34