TU_108 – MG_178

Name
WID TU_108 View in model
Name MG_178 View in model
 
Structure (Hayflick media, 37C)
Structure 204014205386 MG_177 MG_178 MG_179
Genes MG_178 View in model
Promoter ‑35 box coordinate (nt) -25
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -7
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -3
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 204514, Length: 372, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
ATGTCATACATTAATAAAGAGGGGAAAACCACAGCTTGAAGAGTGATGAC
AGTGCGTCAGCAAGTGAGTGCAGTGTTAAGTTATGGAAAGATTCAAACCA
CTTTAAAAAAAGCTAAGAACACCCAAAAAAGGTTAGAGAAGATTATTACC
ATTGCTAAAGTTGATAACTTTAACAACCGCAGGGCTGTTAAAAAGTGGTT
ATTAAATACCAATTCATTAGATGTAGATCAACTCACAAACCACCTTTTTA
AAAAAGTAGCACCACGTTTTTTAAAGCGTAATGGTGGTTATAGTAGAGTG
TTAAAGTTGGGAGTTAGAAGGGGTGATAGTACTGAAATGGCGATCTTACA
GCTGATAGATGCTACCAACTAA
50
100
150
200
250
300
350
372
View in model
 
Metadata
Created 2012-10-01 15:09:16
Last updated 2012-10-01 15:18:34