TU_106 – MG_174

Name
WID TU_106 View in model
Name MG_174 View in model
 
Structure (Hayflick media, 37C)
Structure 202147203261 MG_172 MG_173 MG_174 MG_175 MG_176
Genes MG_174 View in model
Promoter ‑35 box coordinate (nt) -38
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -13
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -8
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 202647, Length: 114, Direction: Forward, Sequence:
1
51
101
ATGAAGGTTAGAGCAAGCGTAAAACCAATTTGTAAAGATTGTAAGATCAT
CAAACGTCACCGCATCTTAAGGGTGATCTGCAAAACCAAAAAACACAAGC
AAAGGCAAGGATAA
50
100
114
View in model
 
Metadata
Created 2012-10-01 15:09:16
Last updated 2012-10-01 15:18:34