TU_099 – MG_150

Name
WID TU_099 View in model
Name MG_150 View in model
 
Structure (Hayflick media, 37C)
Structure 189546190867 MG_150 MG_151 MG_478
Genes MG_150 View in model
Promoter ‑35 box coordinate (nt) -62
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -41
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -32
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 190046, Length: 321, Direction: Forward, Sequence:
1
51
101
151
201
251
301
ATGAATAGCGCTGTAAAATATCCTGAGCTGAAGATCAAACTTGAGTCTTA
TGATAGCACCCTTTTAGATCTCACTATTAAAAAGATAGTTGAGGTTGTAA
AGGGTGTGAACATTAAGATTAAAGGTCCTTTACCTTTGCCTACTAAAAAG
GAAGTGATCACCATTATCCGCTCTCCCCATGTTGATAAAGCATCCAGAGA
GCAGTTTGAAAAAAATACCCACAAGCGCTTAATGATTCTTGTTGATGTTA
ATCAAGGAGGGATTGATAGTTTAAAAAAGATTAAGATCCCAGTTGGGGTT
ACACTGCGTTTTTCAAAATAG
50
100
150
200
250
300
321
View in model
 
Metadata
Created 2012-10-01 15:09:16
Last updated 2012-10-01 15:18:34