TU_098 – MG_478

Name
WID TU_098 View in model
Name MG_478 View in model
 
Structure (Hayflick media, 37C)
Structure 188992190457 MG_149 MG_150 MG_151 MG_478
Genes MG_478 View in model
Promoter ‑35 box coordinate (nt) 6
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) 35
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) 40
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 189492, Length: 465, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGACAGTGTACACTTACACTGTTTTTTTATTTAATTGAGAAAATATTGG
GTTGATGGAACAACAAAACCCTGATCGTTTAAAAAAAGATAGGGAACTTA
TTTATGCAATTGTTACAGCTAAAGGTATCATTAGCCGTTTCTTTTGATCA
ATCCTTAGTTTTTTAATTACTAACCTTATCTTCTTTTTTGCAGCTTTTGT
AGCGCTCTTAATTTATCTGTTAGCAAGTGTTGATAATCAGTTTGCATTTG
TTTTTATTGCTGCAATTATCTTCATTATTTTTTACAACATCTTCTTTTTA
AGTTACCTGTTGTTTATCTATTTTAAGGGCCAGAAAGCAATTGAAAACAA
CTGTAAGTACCTGTTAACAATCCTTGATATTAAGAGTGATGAACTGTTAC
CTTTTTCGCTTTTAGGTAGTTTAAGAAAAGGTTATATGCTAGATGAAATG
CTCTTAGAACAGTAA
50
100
150
200
250
300
350
400
450
465
View in model
 
Metadata
Created 2012-10-01 15:09:16
Last updated 2012-10-01 15:18:34