TU_091 – MG_477

Name
WID TU_091 View in model
Name MG_477 View in model
 
Structure (Hayflick media, 37C)
Structure 180246181519 MG_141 MG_142 MG_477
Genes MG_477 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 180746, Length: 273, Direction: Forward, Sequence:
1
51
101
151
201
251
ATGCAACTAATAACAAGACTTTGTTTATTAACAAGAAAACATTTTGTTAA
AAGAGAACTTTTACGTCTTGTAAAATTAGACAACCAACTTGAAATTGATC
TTAATCAAAATCTCAAGGGCAGGGGTTATTATTTGAGTGTTTTTGGTTTA
AAGCTAGATAAAAAACACCTCAAAGCTGTAGTTGAAAAACACCTTAAGGT
TAGTTGTAATGATGCAAAGCTTACTGCAATGATTACCGCCTTACAACAAT
TAGCACAAGATGAAAAAAAATAG
50
100
150
200
250
273
View in model
 
Metadata
Created 2012-10-01 15:09:16
Last updated 2012-10-01 15:18:33