TU_084 – MG_134

Name
WID TU_084 View in model
Name MG_134 View in model
 
Structure (Hayflick media, 37C)
Structure 159298160601 MG_133 MG_134 MG_135
Genes MG_134 View in model
Promoter ‑35 box coordinate (nt) -64
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -35
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -32
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 159798, Length: 303, Direction: Forward, Sequence:
1
51
101
151
201
251
301
ATGAGTTTTAAAAAGATTGCTGAAATGATGCGTCAAGCAGAACGAGAAAC
TAAGAAAAAAACATTAGCGTTTGAACAACAAGCCTTTGAATACAACTATA
AAAATGGTGCGATTAAGATCACTATTTTAGGTGATCTTACACTTAAATCA
ATTAACATCGATCCTGTTTTGATTGATGCAAGTGACAAAGTTATTCTAGA
GGAGATGATTATAGAAGCTACTAATGAAGCGGTTAGTGATGTGAAAACCA
AGTATGATAACTTAGTTGAGAAAACTATGCCAAAAGTTCCAGGTCTTTTC
TAA
50
100
150
200
250
300
303
View in model
 
Metadata
Created 2012-10-01 15:09:16
Last updated 2012-10-01 15:18:33