TU_082 – MG_132

Name
WID TU_082 View in model
Name MG_132 View in model
 
Structure (Hayflick media, 37C)
Structure 158081159507 MG_131 MG_132 MG_133
Genes MG_132 View in model
Promoter ‑35 box coordinate (nt) -36
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -12
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -9
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 158581, Length: 426, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
ATGGAAAAAAACACCACAAGTAGTTGTATCTTTTGTGATATTGTTCAAGG
TTCAATTACATCCTATAAAATTGGAGAAAATGAGCATGCCATTGCTTTTT
TAGATGCTTTTCCTGTAGCTGATGGTCATACTTTAGTAATCCCTAAAAAA
CATGCAGTTGATTTTTCTTCAACTGATCAAAAAGAGTTACAAGCAGTTAG
TTTATTAGCAAAACAAATCGCTTTAAAACTAAAGATGACACTAAAACCAT
CTGGTTTAAACTATGTTTCTAATGAAGGGGCAATTGCAGGTCAAGTGGTT
TTTCATTTTCACTTACACATAGTACCCAAATATGAAACTGGTAAAGGGTT
TGGCTATAATGTCAATAAAACCAACAAACGTTCCTTAGAAGAAAACTACC
AACTAATATCTGAAAGCAAAAATTAA
50
100
150
200
250
300
350
400
426
View in model
 
Metadata
Created 2012-10-01 15:09:16
Last updated 2012-10-01 15:18:33