TU_081 – MG_131

Name
WID TU_081 View in model
Name MG_131 View in model
 
Structure (Hayflick media, 37C)
Structure 157523158810 MG_130 MG_131 MG_132
Genes MG_131 View in model
Promoter ‑35 box coordinate (nt) -57
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -33
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -25
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 158023, Length: 287, Direction: Forward, Sequence:
1
51
101
151
201
251
ATGCAATACAGTGCTTTAATACCACTTTTTATATTACTAATTAGCTTAGT
ATTATTTTGTTTCAGCTTTAGAAAAAATCAAAGTGAAAATCAGATAGTGA
AAATCTTATTTTTTGCTTATTGCATCGATTTTTTAGCTTTAATTCTTGCT
GTAATGTTGCTCACTTTTTTAAGTCATGGGTTGTTAAGTTTAGCGATTTT
AATCCCTGTCTTAGTTTTTCAATAATAATGTTTTTTGTTATGGTTATTAG
TCACTATCCCCTTATGAAAAGACTATTTGGAAATTAA
50
100
150
200
250
287
View in model
 
Metadata
Created 2012-10-01 15:09:15
Last updated 2012-10-01 15:18:33