TU_079 – MG_129

Name
WID TU_079 View in model
Name MG_129 View in model
 
Structure (Hayflick media, 37C)
Structure 155723157077 MG_128 MG_129 MG_130
Genes MG_129 View in model
Promoter ‑35 box coordinate (nt) -52
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -23
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -20
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 156223, Length: 354, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
ATGAAATGGTTGTTGTGATTGGGTTATATTTTTAGTTTTGGTTTACTCTA
TCTTTGGATAGTAAAAAAATCAAAACAAATTGCTCAACAACCTAACACAA
AACTGGTTGAATCAACTTCTATTCCTTTTAAAGTTAAGGACTTTGTTAGT
GCTTGTGGTGGTAAGGAAAATTTTGTTAATATAAAAACAACACCAACTCA
ATTAATAGTTACTTTTAAAGATGTTAACTCAGTGAGCTTAACAAAGCTTA
ATGCGCTTAATATCAAAGGAATTAACAAAAACCAAAACCAATTTCGTTTT
GTACTTGGTAACTTTGTAAATGAATTGAAAAAAAAGATAGAAGATGAACA
ATAA
50
100
150
200
250
300
350
354
View in model
 
Metadata
Created 2012-10-01 15:09:15
Last updated 2012-10-01 15:18:33