TU_072 – MG_115

Name
WID TU_072 View in model
Name MG_115 View in model
 
Structure (Hayflick media, 37C)
Structure 141581143055 MG_114 MG_115 MG_116
Genes MG_115 View in model
Promoter ‑35 box coordinate (nt) -72
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -43
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -34
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 142081, Length: 474, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
TTGTTTGCCAATTTAATAGCAGAAAAACTCCAAAAGTTACAACTTAGTGT
TGCAACAGCTGAATCAGTTACTGGTGGCTTATTAGCTCATTGTTTAACTT
CCATTGATGGTGCTTCTAACTATTTTAATGGCGGTGTTATTGCTTACAAT
AACCAAGTTAAGATTAACTTACTGAATGTTCAATCCTCCACAATTGCAAA
CCATGGGGCAGTTTCCAGTTTCTGTGCTAGGGAGATGGCAGTTGGGGTTA
AACAAAAGTTTCAAGCTGATGTGGGTATTGCTTGCAGTGGGATAGCAGGT
AGTAAAGCAGTTGAAAATAAAGCAATAGGATTACTTTTTTTCTGTATTAT
TATAGGAAATAAGGCTTATGATTTTGAGTTTGAAATGAACCAAAATAATC
GTAAGGATAACATTGAATTATTTACCAATAAGATCTTGGAATCTTTCCAC
TATTTGTTAACAAAGCTAGCTTAA
50
100
150
200
250
300
350
400
450
474
View in model
 
Metadata
Created 2012-10-01 15:09:15
Last updated 2012-10-01 15:18:32