TU_071 – MG_114

Name
WID TU_071 View in model
Name MG_114 View in model
 
Structure (Hayflick media, 37C)
Structure 140846142557 MG_113 MG_114 MG_115
Genes MG_114 View in model
Promoter ‑35 box coordinate (nt) -26
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -7
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) 1
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 141346, Length: 711, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
GTGGATTGGAAAACATCAGAGATGCTATTCCCTTTCCCCGTGTACATGGC
ACCATTAACTTCTAAATTCGCTGCTTATAAAAAAAAGATTGCAAACTGGT
TAACAGTTTACAGAATTTTTATTGCTTTACCTACTATTATTTTTATTGCT
TTAGATAATCAACTAGGAGTTTTAGCTAACTTTTCTGTTGGTGCAATTAG
CATTAGTTTACAGATCAGTTTATTGATTGGAGGATTTTTGTTTTTAACTG
CAGTTATATCAGATTATTTAGATGGATATTTAGCAAGAAAATGGCTAGCA
GTTTCTAACTTTGGTAAATTATGAGACCCCATTGCTGATAAAGTGATTAT
CAATGGTGTTCTTATTGCACTAGCGATTAATGGATATTTTCACTTTAGCT
TATTAATTGTTTTTATAGTCCGTGATCTTGTGTTGGATGGAATGCGGATT
TATGCTTATGAGAAAAAGGTGGTTATTGCTGCTAACTGACTTGGAAAATG
AAAAACTATCATGCAGATGGTTGGTATTGTTTTTAGTTGTTTTGTTTGGA
GTTTTAAACAAAGTGAAATAGCTTCTTTGAATAGTGGACTGTTCTTTTGA
TTACTAACTCAACTGCCATATTATTTAGCAGCAGTTTTTTCAATTTGGTC
TTTCATTGTTTATAACATCCAAATATATCAGCAACTAAAGGCTTATAACT
CCAAGTTATAA
50
100
150
200
250
300
350
400
450
500
550
600
650
700
711
View in model
 
Metadata
Created 2012-10-01 15:09:15
Last updated 2012-10-01 15:18:32