TU_067 – MG_106

Name
WID TU_067 View in model
Name MG_106 View in model
 
Structure (Hayflick media, 37C)
Structure 133647135229 MG_105 MG_106 MG_107
Genes MG_106 View in model
Promoter ‑35 box coordinate (nt) -142
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -120
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -111
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 134147, Length: 582, Direction: Reverse, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
ATGACTTTTCAACCAACTAAAACTTGGCTTGTTTTTGATGATAATGCTTT
GATTAACAAGCCAACTGAAGCTGTTAATTTTCCAATAGATGAGCAAATTG
AAACCTGTATTAAAAAGATGATTGCATATGTTGATGCTTCATATGATGGT
AAAGCACAAGAATATGACATTATTCCAGGAATTGGGATAGCTGCTAACCA
GATTGGCTATTGAAAACAACTGTTTTACATCCACCTCAATGATTTAAACA
AAGAAAAAAAGTGCCTACTGATCAATCCTAAAATTATTGATCAAAGTGAA
AATAAAGCATTTTTAGAAAGTGGTGAGGGGTGTTTAAGTGTTAAAAAGCA
GCACAAAGGTTATGTAATTCGTAGTGAATGGATCACTATTAAAGGTTATG
ATTGGTTTGAAAAAAAAGAGATTACCATTAAAGCAACTGGACTATTTGGA
ATGTGTTTACAGCATGAATTTGATCACTTACAGGGACGCTTTTTTTACCA
AAGAATTAACCCTTTGAATCCATGGTTTAAAAAACCAGAATGAAAAGTGA
TTAATCCTACTTTGAAGACAAGTAATGGATAA
50
100
150
200
250
300
350
400
450
500
550
582
View in model
 
Metadata
Created 2012-10-01 15:09:15
Last updated 2012-10-01 15:18:32