TU_066 – MG_105

Name
WID TU_066 View in model
Name MG_105 View in model
 
Structure (Hayflick media, 37C)
Structure 133070134673 MG_104 MG_105 MG_106
Genes MG_105 View in model
Promoter ‑35 box coordinate (nt) -25
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -7
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -1
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 133570, Length: 603, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
ATGGTTGTTAATATCCTGCTTTTTATTACCCTTATTTTTTTACTTTTACT
GTTTGTTTTTTTAATTGCTTTTGCATTTCTAAACAAACGGGTTAGAAATT
ATGTTGTACGTACTTGAACTAGTGTTTTCAGTAAGTCCAAACAAAACCTT
GATAAAAAGAACTTTTTTGACAATTTAACTTCAACTTTATTAAGACTTTC
AGTTGATAAAATTGGGGCTATTATTGCCATTGAAAAACGTGATTCACTTG
ATCCTTATATCAACATTGGTTATCGGGTTAGTTCTGATTTTTCCCCTGAA
CTGTTAGTTACTATTTTTTACAACAAATCATCTCCTTTACATGATGGAGC
GGTGATTGTTAGAGATTACAAAATTATTAGTGTCTCTTCTTACTTTCCAA
TGACAAGACAATTAATTGATGTTTCATATGGTTCAAGACACAGAAGTGCC
TTGGGATTAAGTGAAAAGTCTGATGCAGTTGTTTTTATTGTTAGTGAAAC
AACTGGTAAAATATCAGTTGCTTTAAAAGGGGTTATTAAAACCTTGTCTT
CCAACTCAGATAGGTTGCAAGATGAAATTATCCATTACTTGTCTTCAAAG
TAG
50
100
150
200
250
300
350
400
450
500
550
600
603
View in model
 
Metadata
Created 2012-10-01 15:09:15
Last updated 2012-10-01 15:18:32