TU_064 – MG_476

Name
WID TU_064 View in model
Name MG_476 View in model
 
Structure (Hayflick media, 37C)
Structure 130649131883 MG_103 MG_104 MG_476
Genes MG_476 View in model
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 131149, Length: 234, Direction: Forward, Sequence:
1
51
101
151
201
ATGCATCCAATCCAAATAGTAATGTTCATTATGGCTGTTATCTGTTTAAT
TATTGGACTTTTGCTTTCTAACCATGGTTCTACTGGAGGATTAGCTTCTC
TATCAGGTCAGGACTTGGAGATCTTTCGTAAAACCAAAGATAGGGGTTTT
GTAAAGATCTTACAGATTATCATGTTTATCTTAGTAGTTTTATTTTTAAT
TCTTGGGTTGATATTTAGTTTTGCACCAAGATAA
50
100
150
200
234
View in model
 
Metadata
Created 2012-10-01 15:09:15
Last updated 2012-10-01 15:18:32