TU_058 – MG_092

Name
WID TU_058 View in model
Name MG_092 View in model
 
Structure (Hayflick media, 37C)
Structure 117525118843 MG_091 MG_092 MG_093
Genes MG_092 View in model
Promoter ‑35 box coordinate (nt) -71
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -42
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -37
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 118025, Length: 318, Direction: Forward, Sequence:
1
51
101
151
201
251
301
GTGATGATTAATAAAGAACAGGATTTAAACCAATTAGAAACCAACCAAGA
ACAGAGTGTTGAACAAAACCAAACTGATGAAAAGCGCAAGCCAAAACCAA
ACTTTAAAAGAGCAAAAAAATATTGTCGATTTTGCGCCATAGGTCAACTA
AGGATTGATTTTATTGATGATTTGGAAGCAATCAAACGCTTTCTCAGTCC
CTATGCAAAGATTAATCCTAGAAGAATTACAGGTAATTGCAACATGCACC
AACGTCATGTAGCTAATGCTCTAAAACGAGCACGTTACCTAGCTTTAGTG
CCATTTATTAAAGATTAA
50
100
150
200
250
300
318
View in model
 
Metadata
Created 2012-10-01 15:09:15
Last updated 2012-10-01 15:18:32