TU_057 – MG_091

Name
WID TU_057 View in model
Name MG_091 View in model
 
Structure (Hayflick media, 37C)
Structure 117053118536 MG_090 MG_091 MG_092 MG_093
Genes MG_091 View in model
Promoter ‑35 box coordinate (nt) -80
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -50
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -41
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 117553, Length: 483, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
ATGAACCGGGTCTTCTTGTTTGGTAAACTCAGTTTTACTCCCAACCGTTT
ACAGACAAAAAATGGTACGTTAGGAGCTACTTTTTCCATGGAATGTCTTG
ATTCCAGTGGTTTTAATAATGCCAAATCATTCATTAGAGTAACTGCTTGA
GGTAAAGTTGCTAGTTTTATTGTTGCTCAAAATCCTGGGGTGATGCTTTT
TGTAGAAGGAAGATTAACTACATATAAAATTACTAACAGTGAAAATAAAA
ACACCTATGCTTTACAAGTAACTGCTGATAAGATCTTTCATCCTGATGAA
AAAACTACCAATGAAGAACCTATTAAATCAACTGTAGTTGATTCACCCTT
TATGAATCCCAAAGCAAGTGTTACAGAAGCTGAGTTTGAACAAGCATTCC
CCCATCAAGATGAAACTGATTTTAACAACATTACCCCTATATTTGAAAAT
GATGTCCAACTAGAGGAGGAAAGTGATGATTAA
50
100
150
200
250
300
350
400
450
483
View in model
 
Metadata
Created 2012-10-01 15:09:15
Last updated 2012-10-01 15:18:32