TU_056 – MG_090

Name
WID TU_056 View in model
Name MG_090 View in model
 
Structure (Hayflick media, 37C)
Structure 116426118053 MG_089 MG_090 MG_091
Genes MG_090 View in model
Promoter ‑35 box coordinate (nt) -63
Promoter ‑35 box length (nt) 6
Promoter ‑10 box coordinate (nt) -37
Promoter ‑10 box length (nt) 6
Transcription start site coordinate (nt) -34
Sequence Chromosome: Mgenitalium_Chr_1, Coordinate: 116926, Length: 627, Direction: Forward, Sequence:
1
51
101
151
201
251
301
351
401
451
501
551
601
ATGCACTACAATATCATTCTTTTAGTTGATGGTACGCTTAGTTTAGAACA
AGCTAACCAAGTTGAACAAAAACACCAAAAATTGCTTGAAAAGGCAACTG
AATTTAAAAGTGAATACTTAGGTTTAAAAGAGTTGGCTTACCCCATTAAA
AAGCAACTTTCTGCTCACTATTACAGATGGAGTTTTCATGGTGAAAGCAA
TTGTACTAAGGAGTTTAAAAGAGCTGCTAACATCAATAAGCAGATAATAA
GAGAGTTAATTATTAACAGAGAAAAAGACTATGGTTATTTAGGTTCAGTT
AACCCTAAAAAACAACAACTGTCTTTGCAGAAGCTAACCAAGTATAATGA
GATTATTGCTAGTGAAAATAATCCTGATAACCCAGATGCGCCTGTCACTT
CTGGTCTAGCTTCTGTTAAACCACGGCTATCAAGAGTTGAAAAACAAAAG
GAACGTGAACTTGAAAAGTGAACGGTTGTTCACCAATCAGGTAACTTTGA
TACTGTACAGATCAATCCTTATCGTCCTAGGATAAAACGCTTTTTACAAA
ACAACCAACAAACCTCCCAAGCTAATAATAACCAACCTCGTTTTCAAAAT
CAATTTAAAAAAGGAGCAAAACCTTAG
50
100
150
200
250
300
350
400
450
500
550
600
627
View in model
 
Metadata
Created 2012-10-01 15:09:15
Last updated 2012-10-01 15:18:32